Examples with SEQUENCE org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE used on opensource projects

Example 16 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project OpenAM by OpenRock.

the class SecureLogHelperJSSImpl method readFromSecretStore.

/**
     * Returns matched secret data from from the secret Storage. 
     * At a time there are only 3 things in logger's secure store file 
     *    - initialkey, currentkey and current signature
     * In the verifier secure store file there is just the initial key of the
     * logger and the currentKey
     * @param filename file for secret storage
     * @param dataType The kind of data to be read, whether it is a
     *                 signature or a key
     * @param password password for the file
     * @return secure data that is matched with dataType
     * @throws Exception if it fails to read secret data from secret store
     */
byte[] readFromSecretStore(String filename, String dataType, AMPassword password) throws Exception {
    // open input file for reading
    FileInputStream infile = null;
    infile = new FileInputStream(filename);
    // Decode the P12 file
    PFX.Template pfxt = new PFX.Template();
    PFX pfx = (PFX) pfxt.decode(new BufferedInputStream(infile, 2048));
    // Verify the MAC on the PFX.  This is important to be sure
    // it hasn't been tampered with.
    StringBuffer reason = new StringBuffer();
    MessageDigest md = MessageDigest.getInstance("SHA");
    Password jssPasswd = new Password(new String(md.digest(password.getByteCopy()), "UTF-8").toCharArray());
    md.reset();
    if (!pfx.verifyAuthSafes(jssPasswd, reason)) {
        throw new Exception("AuthSafes failed to verify because: " + reason.toString());
    }
    AuthenticatedSafes authSafes = pfx.getAuthSafes();
    SEQUENCE safeContentsSequence = authSafes.getSequence();
    byte[] cryptoData = null;
    // Loop over contents of the authenticated safes
    for (int i = 0; i < safeContentsSequence.size(); i++) {
        // The safeContents may or may not be encrypted.  We always send
        // the password in.  It will get used if it is needed.  If the
        // decryption of the safeContents fails for some reason (like
        // a bad password), then this method will throw an exception
        SEQUENCE safeContents = authSafes.getSafeContentsAt(jssPasswd, i);
        SafeBag safeBag = null;
        ASN1Value val = null;
        // Go through all the bags in this SafeContents
        for (int j = 0; j < safeContents.size(); j++) {
            safeBag = (SafeBag) safeContents.elementAt(j);
            // look for bag attributes and then choose the key
            SET attribs = safeBag.getBagAttributes();
            if (attribs == null) {
                Debug.error("Bag has no attributes");
            } else {
                for (int b = 0; b < attribs.size(); b++) {
                    Attribute a = (Attribute) attribs.elementAt(b);
                    if (a.getType().equals(SafeBag.FRIENDLY_NAME)) {
                        // the friendly name attribute is a nickname
                        BMPString bs = (BMPString) ((ANY) a.getValues().elementAt(0)).decodeWith(BMPString.getTemplate());
                        if (dataType.equals(bs.toString())) {
                            // look at the contents of the bag
                            val = safeBag.getInterpretedBagContent();
                            break;
                        }
                    }
                }
            }
        }
        if (val instanceof ANY)
            cryptoData = ((ANY) val).getContents();
    }
    // Close the file
    infile.close();
    return cryptoData;
}

Example 17 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project OpenAM by OpenRock.

the class SecureLogHelperJSSImpl method writeToSecretStore.

/**
     * Writes to the secret Storage. If the data to be written is a key, then
     * writes the older signature also. If it is a signature then writes the
     * older key also
     * @param cryptoMaterial The data to be written to the secret storage
     * @param filename The file for secret storage
     * @param password The password for the file
     * @param dataType The kind of cryptoMaterial, whether it is a signature
     * or a key
     * @throws Exception if it fails to write secret data from secret store
     */
void writeToSecretStore(byte[] cryptoMaterial, String filename, AMPassword password, String dataType) throws Exception {
    byte[] oldDataFromSecretStorage = null;
    String oldDataType = null;
    MessageDigest md = MessageDigest.getInstance("SHA");
    Password jssPasswd = new Password(new String(md.digest(password.getByteCopy()), "UTF-8").toCharArray());
    md.reset();
    // Do this only when the logger's file is being used
    if (filename.equals(logFileName) && loggerInitialized) {
        // current signature in the PKCS12 file
        if (dataType.equals(currentSignature)) {
            oldDataFromSecretStorage = readFromSecretStore(logFileName, currentKey, password);
            oldDataType = currentKey;
        } else if (dataType.equals(currentKey)) {
            // need to read the currentSignature 
            // for the same reason as above
            oldDataFromSecretStorage = readFromSecretStore(logFileName, currentSignature, password);
            oldDataType = currentSignature;
        }
    }
    // Start building the new contents by adding the older content first
    AuthenticatedSafes newAuthSafes = new AuthenticatedSafes();
    if (oldDataFromSecretStorage != null) {
        SEQUENCE oldSafeContents = AddToSecretStore(oldDataFromSecretStorage, oldDataType);
        // Add the old contents to the existing safe
        newAuthSafes.addEncryptedSafeContents(PBEAlgorithm.PBE_SHA1_DES3_CBC, jssPasswd, null, AuthenticatedSafes.DEFAULT_ITERATIONS, oldSafeContents);
    }
    // not being added for the first time
    if ((filename.equals(logFileName)) && !dataType.equals(initialKey) && loggerInitialized) {
        byte[] key = readFromSecretStore(filename, initialKey, password);
        if (key != null) {
            SEQUENCE initialKeySafeContents = AddToSecretStore(key, initialKey);
            newAuthSafes.addEncryptedSafeContents(PBEAlgorithm.PBE_SHA1_DES3_CBC, jssPasswd, null, AuthenticatedSafes.DEFAULT_ITERATIONS, initialKeySafeContents);
        }
    }
    if ((filename.equals(verifierFileName)) && !dataType.equals(initialKey) && verifierInitialized) {
        byte[] key = readFromSecretStore(filename, initialKey, password);
        if (key != null) {
            SEQUENCE initialKeySafeContents = AddToSecretStore(key, initialKey);
            newAuthSafes.addEncryptedSafeContents(PBEAlgorithm.PBE_SHA1_DES3_CBC, jssPasswd, null, AuthenticatedSafes.DEFAULT_ITERATIONS, initialKeySafeContents);
        }
    }
    // Add the new contents
    SEQUENCE encSafeContents = AddToSecretStore(cryptoMaterial, dataType);
    // Add the new contents to the existing safe
    newAuthSafes.addEncryptedSafeContents(PBEAlgorithm.PBE_SHA1_DES3_CBC, jssPasswd, null, AuthenticatedSafes.DEFAULT_ITERATIONS, encSafeContents);
    PFX newpfx = new PFX(newAuthSafes);
    newpfx.computeMacData(jssPasswd, null, 5);
    // write the new PFX out to the logger
    FileOutputStream fos = new FileOutputStream(filename);
    newpfx.encode(fos);
    fos.close();
}

Example 18 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.

the class ModuleDefinitionOutput method getSequenceLength.

private static int getSequenceLength(SBOLDocument document, ComponentDefinition componentDef) throws Exception {
    if (componentDef.getSequences() != null && componentDef.getSequences().size() > 0) {
        Sequence sequence = componentDef.getSequences().iterator().next();
        return sequence.getElements().length();
    } else {
        int total = 0;
        for (SequenceAnnotation annotation : componentDef.getSequenceAnnotations()) {
            if (annotation.getComponent() != null) {
                Component component = annotation.getComponent();
                ComponentDefinition subComponentDef = component.getDefinition();
                total = total + getSequenceLength(document, subComponentDef);
            } else {
                throw new Exception("Can't get sequence length for an incomplete design");
            }
        }
        return total;
    }
}

Example 19 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.

the class SequenceOutput method main.

public static void main(String[] args) throws Exception {
    String prURI = "http://partsregistry.org/";
    SBOLDocument document = new SBOLDocument();
    document.setDefaultURIprefix(prURI);
    document.setTypesInURIs(true);
    Sequence seq = document.createSequence("BBa_J23119", "", "ttgacagctagctcagtcctaggtataatgctagc", URI.create("http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html"));
    seq.addWasDerivedFrom(URI.create("http://parts.igem.org/Part:BBa_J23119:Design"));
    SBOLWriter.write(document, (System.out));
}

Example 20 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.

the class CutExample method main.

public static void main(String[] args) throws Exception {
    String prURI = "http://partsregistry.org/";
    SBOLDocument document = new SBOLDocument();
    document.setDefaultURIprefix(prURI);
    document.setTypesInURIs(true);
    ComponentDefinition promoter = document.createComponentDefinition("BBa_J23119", "", new HashSet<URI>(Arrays.asList(ComponentDefinition.DNA)));
    promoter.addRole(SequenceOntology.PROMOTER);
    promoter.addRole(URI.create("http://identifiers.org/so/SO:0000613"));
    promoter.setName("J23119 promoter");
    promoter.setDescription("Constitutive promoter");
    promoter.addWasDerivedFrom(URI.create("http://partsregistry.org/Part:BBa_J23119"));
    document.setDefaultURIprefix(prURI);
    Sequence seq = document.createSequence("BBa_J23119", "", "ttgacagctagctcagtcctaggtataatgctagc", URI.create("http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html"));
    seq.addWasDerivedFrom(URI.create("http://parts.igem.org/Part:BBa_J23119:Design"));
    promoter.addSequence(seq.getIdentity());
    promoter.createSequenceAnnotation("cutat10", "cut1", 10, OrientationType.INLINE);
    promoter.createSequenceAnnotation("cutat12", "cut2", 12, OrientationType.INLINE);
    SBOLWriter.write(document, (System.out));
}