use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project jasn1 by openmuc.
the class BerClassWriter method writeSequenceDecodeFunction.
private void writeSequenceDecodeFunction(List<AsnElementType> componentTypes, boolean hasExplicitTag) throws IOException {
write("public int decode(InputStream is, boolean withTag) throws IOException {");
write("int codeLength = 0;");
write("int subCodeLength = 0;");
write("BerTag berTag = new BerTag();\n");
write("if (withTag) {");
write("codeLength += tag.decodeAndCheck(is);");
write("}\n");
write("BerLength length = new BerLength();");
write("codeLength += length.decode(is);\n");
write("int totalLength = length.val;");
if (supportIndefiniteLength == true) {
writeSequenceDecodeIndefiniteLenghtPart(componentTypes);
}
write("codeLength += totalLength;\n");
if (hasExplicitTag) {
write("int nextByte = is.read();");
write("if (nextByte == -1) {");
write("throw new EOFException(\"Unexpected end of input stream.\");");
write("}");
write("if (nextByte != (0x30)) {");
write("throw new IOException(\"Tag does not match!\");");
write("}");
write("length.decode(is);");
write("totalLength = length.val;\n");
}
int lastNoneOptionalFieldIndex = -1;
for (int j = 0; j < componentTypes.size(); j++) {
AsnElementType componentType = componentTypes.get(componentTypes.size() - 1 - j);
if (!isOptional(componentType)) {
lastNoneOptionalFieldIndex = componentTypes.size() - 1 - j;
break;
}
}
if (lastNoneOptionalFieldIndex == -1) {
write("if (totalLength == 0) {");
write("return codeLength;");
write("}");
}
write("subCodeLength += berTag.decode(is);");
String initChoiceDecodeLength = "int ";
for (int j = 0; j < componentTypes.size(); j++) {
AsnElementType componentType = componentTypes.get(j);
String explicitEncoding = getExplicitDecodingParameter(componentType);
Tag componentTag = getTag(componentType);
if (componentTag != null) {
write("if (berTag.equals(" + getBerTagParametersString(componentTag) + ")) {");
if (isExplicit(componentTag)) {
write("subCodeLength += length.decode(is);");
}
write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
if (lastNoneOptionalFieldIndex <= j) {
write("if (subCodeLength == totalLength) {");
write("return codeLength;");
write("}");
}
if (j != (componentTypes.size() - 1)) {
write("subCodeLength += berTag.decode(is);");
}
write("}");
if (j == (componentTypes.size() - 1)) {
write("throw new IOException(\"Unexpected end of sequence, length tag: \" + totalLength + \", actual sequence length: \" + subCodeLength);\n");
} else if (!isOptional(componentType)) {
write("else {");
write("throw new IOException(\"Tag does not match the mandatory sequence element tag.\");");
write("}");
}
} else {
if (isDirectAnyOrChoice(componentType)) {
write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
if (isOptional(componentType)) {
write(initChoiceDecodeLength + "choiceDecodeLength = " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
initChoiceDecodeLength = "";
if (j != (componentTypes.size() - 1)) {
write("if (choiceDecodeLength != 0) {");
write("subCodeLength += choiceDecodeLength;");
if (lastNoneOptionalFieldIndex <= j) {
write("if (subCodeLength == totalLength) {");
write("return codeLength;");
write("}");
}
write("subCodeLength += berTag.decode(is);");
write("}");
write("else {");
write(getName(componentType) + " = null;");
write("}");
} else {
// if last sequence element
write("subCodeLength += choiceDecodeLength;");
write("if (subCodeLength == totalLength) {");
write("return codeLength;");
write("}");
}
} else {
write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
if (j != (componentTypes.size() - 1)) {
if (lastNoneOptionalFieldIndex <= j) {
write("if (subCodeLength == totalLength) {");
write("return codeLength;");
write("}");
}
write("subCodeLength += berTag.decode(is);");
} else {
write("if (subCodeLength == totalLength) {");
write("return codeLength;");
write("}");
}
}
if (j == (componentTypes.size() - 1)) {
write("throw new IOException(\"Unexpected end of sequence, length tag: \" + totalLength + \", actual sequence length: \" + subCodeLength);\n");
}
} else {
write("if (berTag.equals(" + getClassNameOfComponent(componentType) + ".tag)) {");
write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
if (lastNoneOptionalFieldIndex <= j) {
write("if (subCodeLength == totalLength) {");
write("return codeLength;");
write("}");
}
if (j != (componentTypes.size() - 1)) {
write("subCodeLength += berTag.decode(is);");
}
write("}");
if (j == (componentTypes.size() - 1)) {
write("throw new IOException(\"Unexpected end of sequence, length tag: \" + totalLength + \", actual sequence length: \" + subCodeLength);\n");
} else if (!isOptional(componentType)) {
write("else {");
write("throw new IOException(\"Tag does not match the mandatory sequence element tag.\");");
write("}");
}
}
}
write("");
}
if (componentTypes.isEmpty()) {
write("return subCodeLength;");
}
write("}\n");
}
use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project jasn1 by openmuc.
the class BerClassWriter method writeSetDecodeIndefiniteLenghtPart.
private void writeSetDecodeIndefiniteLenghtPart(List<AsnElementType> componentTypes) throws IOException {
write("if (totalLength == -1) {");
write("subCodeLength += berTag.decode(is);\n");
String initChoiceDecodeLength = "int ";
for (AsnElementType componentType : componentTypes) {
Tag componentTag = getTag(componentType);
write("if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {");
write("int nextByte = is.read();");
write("if (nextByte != 0) {");
write("if (nextByte == -1) {");
write("throw new EOFException(\"Unexpected end of input stream.\");");
write("}");
write("throw new IOException(\"Decoded sequence has wrong end of contents octets\");");
write("}");
write("codeLength += subCodeLength + 1;");
write("return codeLength;");
write("}");
String explicitEncoding;
if (isDirectAnyOrChoice(componentType)) {
if (isExplicit(componentTag)) {
write("if (berTag.equals(" + getBerTagParametersString(componentTag) + ")) {");
write("subCodeLength += length.decode(is);");
explicitEncoding = "null";
} else {
explicitEncoding = "berTag";
}
write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
write(initChoiceDecodeLength + "choiceDecodeLength = " + getName(componentType) + ".decode(is, " + explicitEncoding + ");");
if (!isExplicit(componentTag)) {
initChoiceDecodeLength = "";
}
write("if (choiceDecodeLength != 0) {");
write("subCodeLength += choiceDecodeLength;");
write("subCodeLength += berTag.decode(is);");
write("}");
write("else {");
write(getName(componentType) + " = null;");
write("}\n");
if (isExplicit(componentTag)) {
write("}");
}
} else {
explicitEncoding = ", false";
if (componentTag != null) {
write("if (berTag.equals(" + getBerTagParametersString(componentTag) + ")) {");
if (isExplicit(componentTag)) {
write("codeLength += length.decode(is);");
explicitEncoding = ", true";
}
} else {
write("if (berTag.equals(" + getClassNameOfComponent(componentType) + ".tag)) {");
}
write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
write("subCodeLength += berTag.decode(is);");
write("}");
}
}
write("int nextByte = is.read();");
write("if (berTag.tagNumber != 0 || berTag.tagClass != 0 || berTag.primitive != 0");
write("|| nextByte != 0) {");
write("if (nextByte == -1) {");
write("throw new EOFException(\"Unexpected end of input stream.\");");
write("}");
write("throw new IOException(\"Decoded sequence has wrong end of contents octets\");");
write("}");
write("codeLength += subCodeLength + 1;");
write("return codeLength;");
write("}\n");
}
use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project jasn1 by openmuc.
the class PersonnelRecord method decode.
public int decode(InputStream is, boolean withTag) throws IOException {
int codeLength = 0;
int subCodeLength = 0;
BerTag berTag = new BerTag();
if (withTag) {
codeLength += tag.decodeAndCheck(is);
}
BerLength length = new BerLength();
codeLength += length.decode(is);
int totalLength = length.val;
if (totalLength == -1) {
subCodeLength += berTag.decode(is);
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(Name.tag)) {
name = new Name();
subCodeLength += name.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 0)) {
title = new BerVisibleString();
subCodeLength += title.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ.tag)) {
number = new org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ();
subCodeLength += number.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 1)) {
dateOfHire = new Date();
subCodeLength += dateOfHire.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 2)) {
nameOfSpouse = new Name();
subCodeLength += nameOfSpouse.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 3)) {
children = new Children();
subCodeLength += children.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 4)) {
testBitString = new MyBitString();
subCodeLength += testBitString.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 6)) {
test = new MyInt();
subCodeLength += test.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
test2 = new TestChoice();
int choiceDecodeLength = test2.decode(is, berTag);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
test2 = null;
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
test3 = new TestChoice();
choiceDecodeLength = test3.decode(is, berTag);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
test3 = null;
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 8)) {
subCodeLength += length.decode(is);
test4 = new TestChoice();
choiceDecodeLength = test4.decode(is, null);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
test4 = null;
}
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 9)) {
subCodeLength += length.decode(is);
test5 = new TestChoice();
choiceDecodeLength = test5.decode(is, null);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
test5 = null;
}
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 10)) {
subCodeLength += length.decode(is);
test6 = new TestChoice();
choiceDecodeLength = test6.decode(is, null);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
test6 = null;
}
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
employeeNumberZ = new EmployeeNumberZ();
choiceDecodeLength = employeeNumberZ.decode(is, berTag);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
employeeNumberZ = null;
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerVisibleString.tag)) {
code_ = new BerVisibleString();
subCodeLength += code_.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(TestSequenceOf.tag)) {
testSequenceOf = new TestSequenceOf();
subCodeLength += testSequenceOf.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(TestSequenceOf2.tag)) {
testSequenceOf2 = new TestSequenceOf2();
subCodeLength += testSequenceOf2.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
int nextByte = is.read();
if (nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
if (berTag.equals(BerEmbeddedPdv.tag)) {
embeddedPdv = new BerEmbeddedPdv();
subCodeLength += embeddedPdv.decode(is, false);
subCodeLength += berTag.decode(is);
}
int nextByte = is.read();
if (berTag.tagNumber != 0 || berTag.tagClass != 0 || berTag.primitive != 0 || nextByte != 0) {
if (nextByte == -1) {
throw new EOFException("Unexpected end of input stream.");
}
throw new IOException("Decoded sequence has wrong end of contents octets");
}
codeLength += subCodeLength + 1;
return codeLength;
}
codeLength += totalLength;
subCodeLength += berTag.decode(is);
if (berTag.equals(Name.tag)) {
name = new Name();
subCodeLength += name.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 0)) {
title = new BerVisibleString();
subCodeLength += title.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ.tag)) {
number = new org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ();
subCodeLength += number.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 1)) {
dateOfHire = new Date();
subCodeLength += dateOfHire.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 2)) {
nameOfSpouse = new Name();
subCodeLength += nameOfSpouse.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 3)) {
children = new Children();
subCodeLength += children.decode(is, false);
subCodeLength += berTag.decode(is);
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 4)) {
testBitString = new MyBitString();
subCodeLength += testBitString.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 6)) {
test = new MyInt();
subCodeLength += test.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
test2 = new TestChoice();
int choiceDecodeLength = test2.decode(is, berTag);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
test2 = null;
}
test3 = new TestChoice();
subCodeLength += test3.decode(is, berTag);
subCodeLength += berTag.decode(is);
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 8)) {
subCodeLength += length.decode(is);
test4 = new TestChoice();
subCodeLength += test4.decode(is, null);
subCodeLength += berTag.decode(is);
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 9)) {
subCodeLength += length.decode(is);
test5 = new TestChoice();
subCodeLength += test5.decode(is, null);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 10)) {
subCodeLength += length.decode(is);
test6 = new TestChoice();
subCodeLength += test6.decode(is, null);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
employeeNumberZ = new EmployeeNumberZ();
choiceDecodeLength = employeeNumberZ.decode(is, berTag);
if (choiceDecodeLength != 0) {
subCodeLength += choiceDecodeLength;
subCodeLength += berTag.decode(is);
} else {
employeeNumberZ = null;
}
if (berTag.equals(BerVisibleString.tag)) {
code_ = new BerVisibleString();
subCodeLength += code_.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(TestSequenceOf.tag)) {
testSequenceOf = new TestSequenceOf();
subCodeLength += testSequenceOf.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(TestSequenceOf2.tag)) {
testSequenceOf2 = new TestSequenceOf2();
subCodeLength += testSequenceOf2.decode(is, false);
subCodeLength += berTag.decode(is);
} else {
throw new IOException("Tag does not match the mandatory sequence element tag.");
}
if (berTag.equals(BerEmbeddedPdv.tag)) {
embeddedPdv = new BerEmbeddedPdv();
subCodeLength += embeddedPdv.decode(is, false);
if (subCodeLength == totalLength) {
return codeLength;
}
}
throw new IOException("Unexpected end of sequence, length tag: " + totalLength + ", actual sequence length: " + subCodeLength);
}
use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.
the class ModuleDefinitionOutput method addSequence.
private static Sequence addSequence(SBOLDocument document, ComponentDefinition componentDef, String displayId, URI sequenceType, String elements) throws SBOLValidationException {
Sequence sequence = document.createSequence(displayId, elements, sequenceType);
componentDef.addSequence(sequence.getIdentity());
return sequence;
}
use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.
the class RepressionModel method main.
public static void main(String[] args) throws SBOLValidationException, SBOLConversionException, IOException {
SBOLDocument doc = new SBOLDocument();
doc.setDefaultURIprefix("http://sbols.org/CRISPR_Example/");
doc.setComplete(true);
doc.setCreateDefaults(true);
String version = "1.0.0";
// Create ComponentDefinition for cas9_generic protein
doc.createComponentDefinition("cas9_generic", version, ComponentDefinition.PROTEIN);
// Create ComponentDefinition for gRNA_generic RNA
doc.createComponentDefinition("gRNA_generic", version, ComponentDefinition.RNA).addRole(SequenceOntology.SGRNA);
// Create ComponentDefinition for cas9_gRNA_complex
doc.createComponentDefinition("cas9_gRNA_complex", version, ComponentDefinition.COMPLEX);
// Create ComponentDefinition for target gene
doc.createComponentDefinition("target_gene", version, ComponentDefinition.DNA).addRole(SequenceOntology.PROMOTER);
// Create ComponentDefinition for target protein
doc.createComponentDefinition("target", version, ComponentDefinition.PROTEIN);
// Create ModuleDefinition for CRISPR_Repression_Template
ModuleDefinition CRISPR_Template = doc.createModuleDefinition("CRISPR_Template", version);
// Complex Formation Interaction for Cas9m_BFP and gRNA
Interaction Cas9Complex_Formation = CRISPR_Template.createInteraction("cas9_complex_formation", SystemsBiologyOntology.NON_COVALENT_BINDING);
Cas9Complex_Formation.createParticipation("cas9_generic", "cas9_generic", SystemsBiologyOntology.REACTANT);
Cas9Complex_Formation.createParticipation("gRNA_generic", "gRNA_generic", SystemsBiologyOntology.REACTANT);
Cas9Complex_Formation.createParticipation("cas9_gRNA_complex", "cas9_gRNA_complex", SystemsBiologyOntology.PRODUCT);
// Production of target from target gene
Interaction EYFP_production = CRISPR_Template.createInteraction("target_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
EYFP_production.createParticipation("target_gene", "target_gene", SystemsBiologyOntology.PROMOTER);
EYFP_production.createParticipation("target", "target", SystemsBiologyOntology.PRODUCT);
// Inhibition of target by cas9m_BFP_gRNA
Interaction target_generic_gene_inhibition = CRISPR_Template.createInteraction("target_gene_inhibition", SystemsBiologyOntology.INHIBITION);
target_generic_gene_inhibition.createParticipation("cas9_gRNA_complex", "cas9_gRNA_complex", SystemsBiologyOntology.INHIBITOR);
target_generic_gene_inhibition.createParticipation("target_gene", "target_gene", SystemsBiologyOntology.PROMOTER);
// Create Sequence for CRa_U6 promoter
String CRa_U6_seq_elements = "GGTTTACCGAGCTCTTATTGGTTTTCAAACTTCATTGACTGTGCC" + "AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT" + "TTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT" + "TTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA" + "AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT" + "AAAATGGACTATCATATGCTTACCGTAACTTGAAATATAGAACCG" + "ATCCTCCCATTGGTATATATTATAGAACCGATCCTCCCATTGGCT" + "TGTGGAAAGGACGAAACACCGTACCTCATCAGGAACATGTGTTTA" + "AGAGCTATGCTGGAAACAGCAGAAATAGCAAGTTTAAATAAGGCT" + "AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT" + "TTGGTGCGTTTTTATGCTTGTAGTATTGTATAATGTTTTT";
doc.createSequence("CRa_U6_seq", version, CRa_U6_seq_elements, Sequence.IUPAC_DNA);
// Create Sequence for gRNA_b coding sequence
String gRNA_b_elements = "AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT" + "TTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT" + "TTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA" + "AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT" + "AAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGAT" + "TTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACCT" + "CATCAGGAACATGTGTTTAAGAGCTATGCTGGAAACAGCAGAAAT" + "AGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG" + "CACCGAGTCGGTGCTTTTTTT";
doc.createSequence("gRNA_b_seq", version, gRNA_b_elements, Sequence.IUPAC_DNA);
// Create Sequence for mKate
String mKate_seq_elements = "TCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTG" + "TACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCC" + "GAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATC" + "AAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTG" + "GCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAACCACACC" + "CAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGTAAGT" + "GGTCCTACCTCATCAGGAACATGTGTTTTAGAGCTAGAAATAGCA" + "AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC" + "GAGTCGGTGCTACTAACTCTCGAGTCTTCTTTTTTTTTTTCACAG" + "GGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTG" + "CTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATC" + "TACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCT" + "GTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCACCGAGATG" + "CTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCC" + "CTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACC" + "ACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGC" + "GTCTACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC" + "AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATAC" + "TGCG";
doc.createSequence("mKate_seq", version, mKate_seq_elements, Sequence.IUPAC_DNA);
// Create Sequence for CRP_b promoter
String CRP_b_seq_elements = "GCTCCGAATTTCTCGACAGATCTCATGTGATTACGCCAAGCTACG" + "GGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAG" + "TACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTTCTGTC" + "CTCCGAGCGGAGACTCTAGATACCTCATCAGGAACATGTTGGAAT" + "TCTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTA" + "GTGAACCGTCAGATCGCCTCGAGTACCTCATCAGGAACATGTTGG" + "ATCCAATTCGACC";
doc.createSequence("CRP_b_seq", version, CRP_b_seq_elements, Sequence.IUPAC_DNA);
// Create ComponentDefinition for a Constitutive Promoter
doc.createComponentDefinition("pConst", version, ComponentDefinition.DNA).addRole(SequenceOntology.PROMOTER);
// Create ComponentDefinition for cas9m_BFP coding sequence
doc.createComponentDefinition("cas9m_BFP_cds", version, ComponentDefinition.DNA).addRole(SequenceOntology.CDS);
// Create ComponentDefinition for cas9m_BFP gene
ComponentDefinition cas9m_BFP_gene = doc.createComponentDefinition("cas9m_BFP_gene", version, ComponentDefinition.DNA);
cas9m_BFP_gene.addRole(SequenceOntology.PROMOTER);
cas9m_BFP_gene.createSequenceConstraint("cas9m_BFP_gene_constraint", RestrictionType.PRECEDES, "pConst", "cas9m_BFP_cds");
// Create ComponentDefintion for cas9m_BFP protein
doc.createComponentDefinition("cas9m_BFP", version, ComponentDefinition.PROTEIN);
// Create ComponentDefintion for CRa_U6 promoter
ComponentDefinition CRa_U6 = doc.createComponentDefinition("CRa_U6", version, ComponentDefinition.DNA);
CRa_U6.addRole(SequenceOntology.PROMOTER);
CRa_U6.addSequence("CRa_U6_seq");
// Create ComponentDefintion for gRNA_b coding sequence
ComponentDefinition gRNA_b_nc = doc.createComponentDefinition("gRNA_b_nc", version, ComponentDefinition.DNA);
gRNA_b_nc.addRole(SequenceOntology.CDS);
gRNA_b_nc.addSequence("gRNA_b_seq");
// Create ComponentDefinition for gRNA_b terminator
doc.createComponentDefinition("gRNA_b_terminator", version, ComponentDefinition.DNA).addRole(SequenceOntology.TERMINATOR);
// Create ComponentDefinition for gRNA_b gene
ComponentDefinition gRNA_b_gene = doc.createComponentDefinition("gRNA_b_gene", version, ComponentDefinition.DNA);
gRNA_b_gene.addRole(SequenceOntology.PROMOTER);
gRNA_b_gene.createSequenceConstraint("gRNA_b_gene_constraint1", RestrictionType.PRECEDES, "CRa_U6", "gRNA_b_nc");
gRNA_b_gene.createSequenceConstraint("gRNA_b_gene_constraint2", RestrictionType.PRECEDES, "gRNA_b_nc", "gRNA_b_terminator");
// Create ComponentDefinition for gRNA_b RNA
doc.createComponentDefinition("gRNA_b", version, ComponentDefinition.RNA).addRole(SequenceOntology.SGRNA);
SequenceOntology so = new SequenceOntology();
URI sgrna = so.getURIbyName("sgRNA");
// Create ComponentDefinition for cas9m_BFP gRNA_b complex
doc.createComponentDefinition("cas9m_BFP_gRNA_b", version, ComponentDefinition.COMPLEX);
// Create ComponentDefinition for mKate coding sequence
ComponentDefinition mKate_cds = doc.createComponentDefinition("mKate_cds", version, ComponentDefinition.DNA);
mKate_cds.addRole(SequenceOntology.CDS);
mKate_cds.addSequence("mKate_seq");
// Create ComponentDefinition for mKate gene
ComponentDefinition mKate_gene = doc.createComponentDefinition("mKate_gene", version, ComponentDefinition.DNA);
mKate_gene.addRole(SequenceOntology.PROMOTER);
mKate_gene.createSequenceConstraint("mKate_gene_constraint", RestrictionType.PRECEDES, "pConst", "mKate_cds");
// Create ComponentDefinition for mKate protein
doc.createComponentDefinition("mKate", version, ComponentDefinition.PROTEIN);
// Create ComponentDefinition for Gal4VP16 coding sequence
ComponentDefinition Gal4VP16_cds = doc.createComponentDefinition("Gal4VP16_cds", version, ComponentDefinition.DNA);
Gal4VP16_cds.addRole(SequenceOntology.CDS);
// Create ComponentDefintion for Gal4VP16 gene
ComponentDefinition Gal4VP16_gene = doc.createComponentDefinition("Gal4VP16_gene", version, ComponentDefinition.DNA);
Gal4VP16_gene.addRole(SequenceOntology.PROMOTER);
Gal4VP16_gene.createSequenceConstraint("GAL4VP16_gene_constraint", RestrictionType.PRECEDES, "pConst", "Gal4VP16_cds");
// Create ComponentDefintion for Gal4VP16 protein
doc.createComponentDefinition("Gal4VP16", version, ComponentDefinition.PROTEIN);
// Create ComponentDefinition for CRP_b promoter
ComponentDefinition CRP_b = doc.createComponentDefinition("CRP_b", version, ComponentDefinition.DNA);
CRP_b.addRole(SequenceOntology.PROMOTER);
CRP_b.addSequence("CRP_b_seq");
// Create ComponentDefintiion for EYFP coding sequence
ComponentDefinition EYFP_cds = doc.createComponentDefinition("EYFP_cds", version, ComponentDefinition.DNA);
EYFP_cds.addRole(SequenceOntology.CDS);
// Create ComponentDefinition for EYFP gene
ComponentDefinition EYFP_gene = doc.createComponentDefinition("EYFP_gene", version, ComponentDefinition.DNA);
EYFP_gene.addRole(SequenceOntology.PROMOTER);
EYFP_gene.createSequenceConstraint("EYFP_gene_constraint", RestrictionType.PRECEDES, "CRP_b", "EYFP_cds");
// Create ComponentDefintiion for EYFP protein
doc.createComponentDefinition("EYFP", version, ComponentDefinition.PROTEIN);
// Create ModuleDefintion for CRISPR Repression
ModuleDefinition CRPb_circuit = doc.createModuleDefinition("CRPb_characterization_circuit", version);
// Create the FunctionalComponents for the ModuleDefinition CRISPR_Repression
CRPb_circuit.createFunctionalComponent("cas9m_BFP", AccessType.PRIVATE, "cas9m_BFP", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("cas9m_BFP_gene", AccessType.PRIVATE, "cas9m_BFP_gene", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("gRNA_b", AccessType.PRIVATE, "gRNA_b", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("gRNA_b_gene", AccessType.PRIVATE, "gRNA_b_gene", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("mKate", AccessType.PRIVATE, "mKate", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("mKate_gene", AccessType.PRIVATE, "mKate_gene", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("Gal4VP16", AccessType.PRIVATE, "Gal4VP16", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("Gal4VP16_gene", AccessType.PRIVATE, "Gal4VP16_gene", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("EYFP", AccessType.PRIVATE, "EYFP", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("EYFP_gene", AccessType.PRIVATE, "EYFP_gene", version, DirectionType.NONE);
CRPb_circuit.createFunctionalComponent("cas9m_BFP_gRNA_b", AccessType.PRIVATE, "cas9m_BFP_gRNA_b", version, DirectionType.NONE);
/* Production of mKate from the mKate gene */
Interaction mKate_production = CRPb_circuit.createInteraction("mKate_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
mKate_production.createParticipation("mKate", "mKate", SystemsBiologyOntology.PRODUCT);
mKate_production.createParticipation("mKate_gene", "mKate_gene", SystemsBiologyOntology.PROMOTER);
// Production of GAL4VP16 from the GAL4VP16 gene
Interaction GAL4VP16_production = CRPb_circuit.createInteraction("Gal4VP16_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
GAL4VP16_production.createParticipation("Gal4VP16_gene", "Gal4VP16_gene", SystemsBiologyOntology.PROMOTER);
GAL4VP16_production.createParticipation("Gal4VP16", "Gal4VP16", SystemsBiologyOntology.PRODUCT);
// Production of cas9m_BFP from the cas9m_BFP gene
Interaction cas9m_BFP_production = CRPb_circuit.createInteraction("cas9m_BFP_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
cas9m_BFP_production.createParticipation("cas9m_BFP_gene", "cas9m_BFP_gene", SystemsBiologyOntology.PROMOTER);
cas9m_BFP_production.createParticipation("cas9m_BFP", "cas9m_BFP", SystemsBiologyOntology.PRODUCT);
// Production of gRNA_b from the gRNA_b gene
Interaction gRNA_b_production = CRPb_circuit.createInteraction("gRNA_b_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
gRNA_b_production.createParticipation("gRNA_b_gene", "gRNA_b_gene", SystemsBiologyOntology.PROMOTER);
gRNA_b_production.createParticipation("gRNA_b", "gRNA_b", SystemsBiologyOntology.PRODUCT);
// Activation of EYFP production by GAL4VP16
Interaction EYFP_Activation = CRPb_circuit.createInteraction("EYFP_Activation", SystemsBiologyOntology.STIMULATION);
EYFP_Activation.createParticipation("Gal4VP16", "Gal4VP16", SystemsBiologyOntology.STIMULATOR);
EYFP_Activation.createParticipation("EYFP_gene", "EYFP_gene", SystemsBiologyOntology.PROMOTER);
// Degradation of mKate
Interaction mKate_deg = CRPb_circuit.createInteraction("mKate_deg", SystemsBiologyOntology.DEGRADATION);
mKate_deg.createParticipation("mKate", "mKate", SystemsBiologyOntology.REACTANT);
// Degradation of GAL4VP16
Interaction GAL4VP16_deg = CRPb_circuit.createInteraction("Gal4VP16_deg", SystemsBiologyOntology.DEGRADATION);
GAL4VP16_deg.createParticipation("Gal4VP16", "Gal4VP16", SystemsBiologyOntology.REACTANT);
// Degradation of cas9m_BFP
Interaction cas9m_BFP_deg = CRPb_circuit.createInteraction("cas9m_BFP_deg", SystemsBiologyOntology.DEGRADATION);
cas9m_BFP_deg.createParticipation("cas9m_BFP", "cas9m_BFP", SystemsBiologyOntology.REACTANT);
// Degradation of gRNA_b
Interaction gRNA_b_deg = CRPb_circuit.createInteraction("gRNA_b_deg", SystemsBiologyOntology.DEGRADATION);
gRNA_b_deg.createParticipation("gRNA_b", "gRNA_b", SystemsBiologyOntology.REACTANT);
// Degradation of EYFP
Interaction EYFP_deg = CRPb_circuit.createInteraction("EYFP_deg", SystemsBiologyOntology.DEGRADATION);
EYFP_deg.createParticipation("EYFP", "EYFP", SystemsBiologyOntology.REACTANT);
// Degradation of cas9m_BFP_gRNA_b
Interaction cas9m_BFP_gRNA_b_deg = CRPb_circuit.createInteraction("cas9m_BFP_gRNA_b_deg", SystemsBiologyOntology.DEGRADATION);
cas9m_BFP_gRNA_b_deg.createParticipation("cas9m_BFP_gRNA_b", "cas9m_BFP_gRNA_b", SystemsBiologyOntology.REACTANT);
// Create Template Module
Module Template_Module = CRPb_circuit.createModule("CRISPR_Template", "CRISPR_Template", version);
// Add MapsTos to Template Module
Template_Module.createMapsTo("cas9m_BFP_map", RefinementType.USELOCAL, "cas9m_BFP", "cas9_generic");
Template_Module.createMapsTo("gRNA_b_map", RefinementType.USELOCAL, "gRNA_b", "gRNA_generic");
Template_Module.createMapsTo("cas9m_BFP_gRNA_map", RefinementType.USELOCAL, "cas9m_BFP_gRNA_b", "cas9_gRNA_complex");
Template_Module.createMapsTo("EYFP_map", RefinementType.USELOCAL, "EYFP", "target");
Template_Module.createMapsTo("EYFP_gene_map", RefinementType.USELOCAL, "EYFP_gene", "target_gene");
// try {
// SBOLWriter.write(doc, "/Users/myers/RepressionModel.rdf");
// }
// catch (XMLStreamException | FactoryConfigurationError | CoreIoException e) {
// e.printStackTrace();
// }
// catch (IOException e) {
// e.printStackTrace();
// }
// END of Repression Model construction. Code below uses trivial manipulations to show other major methods in the library.
ComponentDefinition cas9_generic1 = doc.getComponentDefinition("cas9_generic", version);
ComponentDefinition cas9_generic2 = doc.getComponentDefinition("cas9_generic", null);
if (cas9_generic1.equals(cas9_generic2)) {
System.out.println("Two Cas9 generic protein objects are equal.");
}
gRNA_b_gene.getSequenceConstraint("gRNA_b_gene_constraint1");
CRISPR_Template.setName("C~R*I!S@P#R-based Repression Template");
if (CRISPR_Template.isSetName()) {
CRISPR_Template.unsetName();
CRISPR_Template.setName("CRISPR-based Repression Template");
}
CRISPR_Template.setDescription("Authors: S. Kiani, J. Beal, M. Ebrahimkhani, J. Huh, R. Hall, Z. Xie, Y. Li, and R. Weiss" + "Titel: Crispr transcriptional repression devices and layered circuits in mammalian cells" + "Journal: Nature Methods, vol. 11, no. 7, pp. 723–726, 2014.");
URI gRNA_b_gene_role2 = URI.create("http://identifiers.org/so/SO:0000613");
gRNA_b_gene.addRole(gRNA_b_gene_role2);
if (gRNA_b_gene.containsRole(gRNA_b_gene_role2)) {
gRNA_b_gene.removeRole(gRNA_b_gene_role2);
}
gRNA_b_gene.clearRoles();
if (!gRNA_b_gene.getRoles().isEmpty()) {
System.out.println("gRNA_b_gene set is not empty.");
}
gRNA_b_gene.setRoles(new HashSet<URI>(Arrays.asList(SequenceOntology.PROMOTER)));
CRP_b.clearSequences();
CRP_b.addSequence("CRP_b_seq");
// CRP_b.addSequence(
// URI.create("http://partsregistry.org/seq/partseq_154")
// );
String prURI = "http://partsregistry.org/";
String prPrefix = "pr";
doc.addNamespace(URI.create(prURI), prPrefix);
ComponentDefinition pConst = doc.getComponentDefinition("pConst", version);
pConst.createAnnotation(new QName(prURI, "experience", prPrefix), URI.create("http://parts.igem.org/Part:BBa_J23119:Experience"));
String myersLabURI = "http://www.async.ece.utah.edu/";
String myersLabPrefix = "myersLab";
doc.addNamespace(URI.create(myersLabURI), myersLabPrefix);
GenericTopLevel datasheet = doc.createGenericTopLevel("datasheet", "1.1", new QName(myersLabURI, "datasheet", myersLabPrefix));
datasheet.setName("Datasheet for Custom Parameters");
datasheet.createAnnotation(new QName(myersLabURI, "characterizationData", myersLabPrefix), URI.create(myersLabURI + "/measurement/BBa_J23119"));
datasheet.createAnnotation(new QName(myersLabURI, "transcriptionRate", myersLabPrefix), 0.75);
pConst.createAnnotation(new QName(myersLabURI, "datasheet", myersLabPrefix), datasheet.getIdentity());
ComponentDefinition pConst_alt = (ComponentDefinition) doc.createCopy(pConst, "pConst_alt");
// pConst_alt.createAnnotation(
// new QName(prURI, "", prPrefix),
// URI.create("http://parts.igem.org/Part:BBa_J23100"));
Sequence pConst_alt_seq = doc.createSequence("pConst_alt_seq", version, "ttgacggctagctcagtcctaggtacagtgctagc", Sequence.IUPAC_DNA);
pConst_alt.addSequence(pConst_alt_seq);
SBOLValidate.validateSBOL(doc, true, true, true);
if (SBOLValidate.getNumErrors() > 0) {
for (String error : SBOLValidate.getErrors()) {
System.out.println(error);
}
return;
}
SBOLWriter.write(doc, (System.out));
SBOLWriter.write(doc, "RepressionModel.rdf");
}
Aggregations