Examples with SEQUENCE org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE used on opensource projects

Example 6 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project jasn1 by openmuc.

the class BerClassWriter method writeSequenceDecodeFunction.

private void writeSequenceDecodeFunction(List<AsnElementType> componentTypes, boolean hasExplicitTag) throws IOException {
    write("public int decode(InputStream is, boolean withTag) throws IOException {");
    write("int codeLength = 0;");
    write("int subCodeLength = 0;");
    write("BerTag berTag = new BerTag();\n");
    write("if (withTag) {");
    write("codeLength += tag.decodeAndCheck(is);");
    write("}\n");
    write("BerLength length = new BerLength();");
    write("codeLength += length.decode(is);\n");
    write("int totalLength = length.val;");
    if (supportIndefiniteLength == true) {
        writeSequenceDecodeIndefiniteLenghtPart(componentTypes);
    }
    write("codeLength += totalLength;\n");
    if (hasExplicitTag) {
        write("int nextByte = is.read();");
        write("if (nextByte == -1) {");
        write("throw new EOFException(\"Unexpected end of input stream.\");");
        write("}");
        write("if (nextByte != (0x30)) {");
        write("throw new IOException(\"Tag does not match!\");");
        write("}");
        write("length.decode(is);");
        write("totalLength = length.val;\n");
    }
    int lastNoneOptionalFieldIndex = -1;
    for (int j = 0; j < componentTypes.size(); j++) {
        AsnElementType componentType = componentTypes.get(componentTypes.size() - 1 - j);
        if (!isOptional(componentType)) {
            lastNoneOptionalFieldIndex = componentTypes.size() - 1 - j;
            break;
        }
    }
    if (lastNoneOptionalFieldIndex == -1) {
        write("if (totalLength == 0) {");
        write("return codeLength;");
        write("}");
    }
    write("subCodeLength += berTag.decode(is);");
    String initChoiceDecodeLength = "int ";
    for (int j = 0; j < componentTypes.size(); j++) {
        AsnElementType componentType = componentTypes.get(j);
        String explicitEncoding = getExplicitDecodingParameter(componentType);
        Tag componentTag = getTag(componentType);
        if (componentTag != null) {
            write("if (berTag.equals(" + getBerTagParametersString(componentTag) + ")) {");
            if (isExplicit(componentTag)) {
                write("subCodeLength += length.decode(is);");
            }
            write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
            write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
            if (lastNoneOptionalFieldIndex <= j) {
                write("if (subCodeLength == totalLength) {");
                write("return codeLength;");
                write("}");
            }
            if (j != (componentTypes.size() - 1)) {
                write("subCodeLength += berTag.decode(is);");
            }
            write("}");
            if (j == (componentTypes.size() - 1)) {
                write("throw new IOException(\"Unexpected end of sequence, length tag: \" + totalLength + \", actual sequence length: \" + subCodeLength);\n");
            } else if (!isOptional(componentType)) {
                write("else {");
                write("throw new IOException(\"Tag does not match the mandatory sequence element tag.\");");
                write("}");
            }
        } else {
            if (isDirectAnyOrChoice(componentType)) {
                write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
                if (isOptional(componentType)) {
                    write(initChoiceDecodeLength + "choiceDecodeLength = " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
                    initChoiceDecodeLength = "";
                    if (j != (componentTypes.size() - 1)) {
                        write("if (choiceDecodeLength != 0) {");
                        write("subCodeLength += choiceDecodeLength;");
                        if (lastNoneOptionalFieldIndex <= j) {
                            write("if (subCodeLength == totalLength) {");
                            write("return codeLength;");
                            write("}");
                        }
                        write("subCodeLength += berTag.decode(is);");
                        write("}");
                        write("else {");
                        write(getName(componentType) + " = null;");
                        write("}");
                    } else {
                        // if last sequence element
                        write("subCodeLength += choiceDecodeLength;");
                        write("if (subCodeLength == totalLength) {");
                        write("return codeLength;");
                        write("}");
                    }
                } else {
                    write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
                    if (j != (componentTypes.size() - 1)) {
                        if (lastNoneOptionalFieldIndex <= j) {
                            write("if (subCodeLength == totalLength) {");
                            write("return codeLength;");
                            write("}");
                        }
                        write("subCodeLength += berTag.decode(is);");
                    } else {
                        write("if (subCodeLength == totalLength) {");
                        write("return codeLength;");
                        write("}");
                    }
                }
                if (j == (componentTypes.size() - 1)) {
                    write("throw new IOException(\"Unexpected end of sequence, length tag: \" + totalLength + \", actual sequence length: \" + subCodeLength);\n");
                }
            } else {
                write("if (berTag.equals(" + getClassNameOfComponent(componentType) + ".tag)) {");
                write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
                write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
                if (lastNoneOptionalFieldIndex <= j) {
                    write("if (subCodeLength == totalLength) {");
                    write("return codeLength;");
                    write("}");
                }
                if (j != (componentTypes.size() - 1)) {
                    write("subCodeLength += berTag.decode(is);");
                }
                write("}");
                if (j == (componentTypes.size() - 1)) {
                    write("throw new IOException(\"Unexpected end of sequence, length tag: \" + totalLength + \", actual sequence length: \" + subCodeLength);\n");
                } else if (!isOptional(componentType)) {
                    write("else {");
                    write("throw new IOException(\"Tag does not match the mandatory sequence element tag.\");");
                    write("}");
                }
            }
        }
        write("");
    }
    if (componentTypes.isEmpty()) {
        write("return subCodeLength;");
    }
    write("}\n");
}

Example 7 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project jasn1 by openmuc.

the class BerClassWriter method writeSetDecodeIndefiniteLenghtPart.

private void writeSetDecodeIndefiniteLenghtPart(List<AsnElementType> componentTypes) throws IOException {
    write("if (totalLength == -1) {");
    write("subCodeLength += berTag.decode(is);\n");
    String initChoiceDecodeLength = "int ";
    for (AsnElementType componentType : componentTypes) {
        Tag componentTag = getTag(componentType);
        write("if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {");
        write("int nextByte = is.read();");
        write("if (nextByte != 0) {");
        write("if (nextByte == -1) {");
        write("throw new EOFException(\"Unexpected end of input stream.\");");
        write("}");
        write("throw new IOException(\"Decoded sequence has wrong end of contents octets\");");
        write("}");
        write("codeLength += subCodeLength + 1;");
        write("return codeLength;");
        write("}");
        String explicitEncoding;
        if (isDirectAnyOrChoice(componentType)) {
            if (isExplicit(componentTag)) {
                write("if (berTag.equals(" + getBerTagParametersString(componentTag) + ")) {");
                write("subCodeLength += length.decode(is);");
                explicitEncoding = "null";
            } else {
                explicitEncoding = "berTag";
            }
            write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
            write(initChoiceDecodeLength + "choiceDecodeLength = " + getName(componentType) + ".decode(is, " + explicitEncoding + ");");
            if (!isExplicit(componentTag)) {
                initChoiceDecodeLength = "";
            }
            write("if (choiceDecodeLength != 0) {");
            write("subCodeLength += choiceDecodeLength;");
            write("subCodeLength += berTag.decode(is);");
            write("}");
            write("else {");
            write(getName(componentType) + " = null;");
            write("}\n");
            if (isExplicit(componentTag)) {
                write("}");
            }
        } else {
            explicitEncoding = ", false";
            if (componentTag != null) {
                write("if (berTag.equals(" + getBerTagParametersString(componentTag) + ")) {");
                if (isExplicit(componentTag)) {
                    write("codeLength += length.decode(is);");
                    explicitEncoding = ", true";
                }
            } else {
                write("if (berTag.equals(" + getClassNameOfComponent(componentType) + ".tag)) {");
            }
            write(getName(componentType) + " = new " + getClassNameOfComponent(componentType) + "();");
            write("subCodeLength += " + getName(componentType) + ".decode(is" + explicitEncoding + ");");
            write("subCodeLength += berTag.decode(is);");
            write("}");
        }
    }
    write("int nextByte = is.read();");
    write("if (berTag.tagNumber != 0 || berTag.tagClass != 0 || berTag.primitive != 0");
    write("|| nextByte != 0) {");
    write("if (nextByte == -1) {");
    write("throw new EOFException(\"Unexpected end of input stream.\");");
    write("}");
    write("throw new IOException(\"Decoded sequence has wrong end of contents octets\");");
    write("}");
    write("codeLength += subCodeLength + 1;");
    write("return codeLength;");
    write("}\n");
}

Example 8 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project jasn1 by openmuc.

the class PersonnelRecord method decode.

public int decode(InputStream is, boolean withTag) throws IOException {
    int codeLength = 0;
    int subCodeLength = 0;
    BerTag berTag = new BerTag();
    if (withTag) {
        codeLength += tag.decodeAndCheck(is);
    }
    BerLength length = new BerLength();
    codeLength += length.decode(is);
    int totalLength = length.val;
    if (totalLength == -1) {
        subCodeLength += berTag.decode(is);
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(Name.tag)) {
            name = new Name();
            subCodeLength += name.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 0)) {
            title = new BerVisibleString();
            subCodeLength += title.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ.tag)) {
            number = new org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ();
            subCodeLength += number.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 1)) {
            dateOfHire = new Date();
            subCodeLength += dateOfHire.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 2)) {
            nameOfSpouse = new Name();
            subCodeLength += nameOfSpouse.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 3)) {
            children = new Children();
            subCodeLength += children.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 4)) {
            testBitString = new MyBitString();
            subCodeLength += testBitString.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 6)) {
            test = new MyInt();
            subCodeLength += test.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        test2 = new TestChoice();
        int choiceDecodeLength = test2.decode(is, berTag);
        if (choiceDecodeLength != 0) {
            subCodeLength += choiceDecodeLength;
            subCodeLength += berTag.decode(is);
        } else {
            test2 = null;
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        test3 = new TestChoice();
        choiceDecodeLength = test3.decode(is, berTag);
        if (choiceDecodeLength != 0) {
            subCodeLength += choiceDecodeLength;
            subCodeLength += berTag.decode(is);
        } else {
            test3 = null;
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 8)) {
            subCodeLength += length.decode(is);
            test4 = new TestChoice();
            choiceDecodeLength = test4.decode(is, null);
            if (choiceDecodeLength != 0) {
                subCodeLength += choiceDecodeLength;
                subCodeLength += berTag.decode(is);
            } else {
                test4 = null;
            }
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 9)) {
            subCodeLength += length.decode(is);
            test5 = new TestChoice();
            choiceDecodeLength = test5.decode(is, null);
            if (choiceDecodeLength != 0) {
                subCodeLength += choiceDecodeLength;
                subCodeLength += berTag.decode(is);
            } else {
                test5 = null;
            }
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 10)) {
            subCodeLength += length.decode(is);
            test6 = new TestChoice();
            choiceDecodeLength = test6.decode(is, null);
            if (choiceDecodeLength != 0) {
                subCodeLength += choiceDecodeLength;
                subCodeLength += berTag.decode(is);
            } else {
                test6 = null;
            }
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        employeeNumberZ = new EmployeeNumberZ();
        choiceDecodeLength = employeeNumberZ.decode(is, berTag);
        if (choiceDecodeLength != 0) {
            subCodeLength += choiceDecodeLength;
            subCodeLength += berTag.decode(is);
        } else {
            employeeNumberZ = null;
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerVisibleString.tag)) {
            code_ = new BerVisibleString();
            subCodeLength += code_.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(TestSequenceOf.tag)) {
            testSequenceOf = new TestSequenceOf();
            subCodeLength += testSequenceOf.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(TestSequenceOf2.tag)) {
            testSequenceOf2 = new TestSequenceOf2();
            subCodeLength += testSequenceOf2.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        if (berTag.tagNumber == 0 && berTag.tagClass == 0 && berTag.primitive == 0) {
            int nextByte = is.read();
            if (nextByte != 0) {
                if (nextByte == -1) {
                    throw new EOFException("Unexpected end of input stream.");
                }
                throw new IOException("Decoded sequence has wrong end of contents octets");
            }
            codeLength += subCodeLength + 1;
            return codeLength;
        }
        if (berTag.equals(BerEmbeddedPdv.tag)) {
            embeddedPdv = new BerEmbeddedPdv();
            subCodeLength += embeddedPdv.decode(is, false);
            subCodeLength += berTag.decode(is);
        }
        int nextByte = is.read();
        if (berTag.tagNumber != 0 || berTag.tagClass != 0 || berTag.primitive != 0 || nextByte != 0) {
            if (nextByte == -1) {
                throw new EOFException("Unexpected end of input stream.");
            }
            throw new IOException("Decoded sequence has wrong end of contents octets");
        }
        codeLength += subCodeLength + 1;
        return codeLength;
    }
    codeLength += totalLength;
    subCodeLength += berTag.decode(is);
    if (berTag.equals(Name.tag)) {
        name = new Name();
        subCodeLength += name.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 0)) {
        title = new BerVisibleString();
        subCodeLength += title.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ.tag)) {
        number = new org.openmuc.jasn1.compiler.modules.module2.EmployeeNumberZ();
        subCodeLength += number.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 1)) {
        dateOfHire = new Date();
        subCodeLength += dateOfHire.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 2)) {
        nameOfSpouse = new Name();
        subCodeLength += nameOfSpouse.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 3)) {
        children = new Children();
        subCodeLength += children.decode(is, false);
        subCodeLength += berTag.decode(is);
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 4)) {
        testBitString = new MyBitString();
        subCodeLength += testBitString.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.PRIMITIVE, 6)) {
        test = new MyInt();
        subCodeLength += test.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    test2 = new TestChoice();
    int choiceDecodeLength = test2.decode(is, berTag);
    if (choiceDecodeLength != 0) {
        subCodeLength += choiceDecodeLength;
        subCodeLength += berTag.decode(is);
    } else {
        test2 = null;
    }
    test3 = new TestChoice();
    subCodeLength += test3.decode(is, berTag);
    subCodeLength += berTag.decode(is);
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 8)) {
        subCodeLength += length.decode(is);
        test4 = new TestChoice();
        subCodeLength += test4.decode(is, null);
        subCodeLength += berTag.decode(is);
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 9)) {
        subCodeLength += length.decode(is);
        test5 = new TestChoice();
        subCodeLength += test5.decode(is, null);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerTag.CONTEXT_CLASS, BerTag.CONSTRUCTED, 10)) {
        subCodeLength += length.decode(is);
        test6 = new TestChoice();
        subCodeLength += test6.decode(is, null);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    employeeNumberZ = new EmployeeNumberZ();
    choiceDecodeLength = employeeNumberZ.decode(is, berTag);
    if (choiceDecodeLength != 0) {
        subCodeLength += choiceDecodeLength;
        subCodeLength += berTag.decode(is);
    } else {
        employeeNumberZ = null;
    }
    if (berTag.equals(BerVisibleString.tag)) {
        code_ = new BerVisibleString();
        subCodeLength += code_.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(TestSequenceOf.tag)) {
        testSequenceOf = new TestSequenceOf();
        subCodeLength += testSequenceOf.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(TestSequenceOf2.tag)) {
        testSequenceOf2 = new TestSequenceOf2();
        subCodeLength += testSequenceOf2.decode(is, false);
        subCodeLength += berTag.decode(is);
    } else {
        throw new IOException("Tag does not match the mandatory sequence element tag.");
    }
    if (berTag.equals(BerEmbeddedPdv.tag)) {
        embeddedPdv = new BerEmbeddedPdv();
        subCodeLength += embeddedPdv.decode(is, false);
        if (subCodeLength == totalLength) {
            return codeLength;
        }
    }
    throw new IOException("Unexpected end of sequence, length tag: " + totalLength + ", actual sequence length: " + subCodeLength);
}

Example 9 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.

the class ModuleDefinitionOutput method addSequence.

private static Sequence addSequence(SBOLDocument document, ComponentDefinition componentDef, String displayId, URI sequenceType, String elements) throws SBOLValidationException {
    Sequence sequence = document.createSequence(displayId, elements, sequenceType);
    componentDef.addSequence(sequence.getIdentity());
    return sequence;
}

Example 10 with SEQUENCE

use of org.openmuc.jasn1.compiler.modules.module1.PersonnelRecord.TestSequenceOf2.SEQUENCE in project libSBOLj by SynBioDex.

the class RepressionModel method main.

public static void main(String[] args) throws SBOLValidationException, SBOLConversionException, IOException {
    SBOLDocument doc = new SBOLDocument();
    doc.setDefaultURIprefix("http://sbols.org/CRISPR_Example/");
    doc.setComplete(true);
    doc.setCreateDefaults(true);
    String version = "1.0.0";
    // Create ComponentDefinition for cas9_generic protein
    doc.createComponentDefinition("cas9_generic", version, ComponentDefinition.PROTEIN);
    // Create ComponentDefinition for gRNA_generic RNA
    doc.createComponentDefinition("gRNA_generic", version, ComponentDefinition.RNA).addRole(SequenceOntology.SGRNA);
    // Create ComponentDefinition for cas9_gRNA_complex
    doc.createComponentDefinition("cas9_gRNA_complex", version, ComponentDefinition.COMPLEX);
    // Create ComponentDefinition for target gene
    doc.createComponentDefinition("target_gene", version, ComponentDefinition.DNA).addRole(SequenceOntology.PROMOTER);
    // Create ComponentDefinition for target protein
    doc.createComponentDefinition("target", version, ComponentDefinition.PROTEIN);
    // Create ModuleDefinition for CRISPR_Repression_Template
    ModuleDefinition CRISPR_Template = doc.createModuleDefinition("CRISPR_Template", version);
    // Complex Formation Interaction for Cas9m_BFP and gRNA
    Interaction Cas9Complex_Formation = CRISPR_Template.createInteraction("cas9_complex_formation", SystemsBiologyOntology.NON_COVALENT_BINDING);
    Cas9Complex_Formation.createParticipation("cas9_generic", "cas9_generic", SystemsBiologyOntology.REACTANT);
    Cas9Complex_Formation.createParticipation("gRNA_generic", "gRNA_generic", SystemsBiologyOntology.REACTANT);
    Cas9Complex_Formation.createParticipation("cas9_gRNA_complex", "cas9_gRNA_complex", SystemsBiologyOntology.PRODUCT);
    // Production of target from target gene
    Interaction EYFP_production = CRISPR_Template.createInteraction("target_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
    EYFP_production.createParticipation("target_gene", "target_gene", SystemsBiologyOntology.PROMOTER);
    EYFP_production.createParticipation("target", "target", SystemsBiologyOntology.PRODUCT);
    // Inhibition of target by cas9m_BFP_gRNA
    Interaction target_generic_gene_inhibition = CRISPR_Template.createInteraction("target_gene_inhibition", SystemsBiologyOntology.INHIBITION);
    target_generic_gene_inhibition.createParticipation("cas9_gRNA_complex", "cas9_gRNA_complex", SystemsBiologyOntology.INHIBITOR);
    target_generic_gene_inhibition.createParticipation("target_gene", "target_gene", SystemsBiologyOntology.PROMOTER);
    // Create Sequence for CRa_U6 promoter
    String CRa_U6_seq_elements = "GGTTTACCGAGCTCTTATTGGTTTTCAAACTTCATTGACTGTGCC" + "AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT" + "TTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT" + "TTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA" + "AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT" + "AAAATGGACTATCATATGCTTACCGTAACTTGAAATATAGAACCG" + "ATCCTCCCATTGGTATATATTATAGAACCGATCCTCCCATTGGCT" + "TGTGGAAAGGACGAAACACCGTACCTCATCAGGAACATGTGTTTA" + "AGAGCTATGCTGGAAACAGCAGAAATAGCAAGTTTAAATAAGGCT" + "AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT" + "TTGGTGCGTTTTTATGCTTGTAGTATTGTATAATGTTTTT";
    doc.createSequence("CRa_U6_seq", version, CRa_U6_seq_elements, Sequence.IUPAC_DNA);
    // Create Sequence for gRNA_b coding sequence
    String gRNA_b_elements = "AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT" + "TTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAAT" + "TTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGA" + "AAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT" + "AAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGAT" + "TTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACCT" + "CATCAGGAACATGTGTTTAAGAGCTATGCTGGAAACAGCAGAAAT" + "AGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGG" + "CACCGAGTCGGTGCTTTTTTT";
    doc.createSequence("gRNA_b_seq", version, gRNA_b_elements, Sequence.IUPAC_DNA);
    // Create Sequence for mKate
    String mKate_seq_elements = "TCTAAGGGCGAAGAGCTGATTAAGGAGAACATGCACATGAAGCTG" + "TACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCC" + "GAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATC" + "AAGGTGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTG" + "GCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAACCACACC" + "CAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCTGAGGTAAGT" + "GGTCCTACCTCATCAGGAACATGTGTTTTAGAGCTAGAAATAGCA" + "AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACC" + "GAGTCGGTGCTACTAACTCTCGAGTCTTCTTTTTTTTTTTCACAG" + "GGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTG" + "CTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATC" + "TACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCT" + "GTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCACCGAGATG" + "CTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAAGCGACATGGCC" + "CTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACC" + "ACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGC" + "GTCTACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGAC" + "AAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATAC" + "TGCG";
    doc.createSequence("mKate_seq", version, mKate_seq_elements, Sequence.IUPAC_DNA);
    // Create Sequence for CRP_b promoter
    String CRP_b_seq_elements = "GCTCCGAATTTCTCGACAGATCTCATGTGATTACGCCAAGCTACG" + "GGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAG" + "TACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTTCTGTC" + "CTCCGAGCGGAGACTCTAGATACCTCATCAGGAACATGTTGGAAT" + "TCTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTA" + "GTGAACCGTCAGATCGCCTCGAGTACCTCATCAGGAACATGTTGG" + "ATCCAATTCGACC";
    doc.createSequence("CRP_b_seq", version, CRP_b_seq_elements, Sequence.IUPAC_DNA);
    // Create ComponentDefinition for a Constitutive Promoter
    doc.createComponentDefinition("pConst", version, ComponentDefinition.DNA).addRole(SequenceOntology.PROMOTER);
    // Create ComponentDefinition for cas9m_BFP coding sequence
    doc.createComponentDefinition("cas9m_BFP_cds", version, ComponentDefinition.DNA).addRole(SequenceOntology.CDS);
    // Create ComponentDefinition for cas9m_BFP gene
    ComponentDefinition cas9m_BFP_gene = doc.createComponentDefinition("cas9m_BFP_gene", version, ComponentDefinition.DNA);
    cas9m_BFP_gene.addRole(SequenceOntology.PROMOTER);
    cas9m_BFP_gene.createSequenceConstraint("cas9m_BFP_gene_constraint", RestrictionType.PRECEDES, "pConst", "cas9m_BFP_cds");
    // Create ComponentDefintion for cas9m_BFP protein
    doc.createComponentDefinition("cas9m_BFP", version, ComponentDefinition.PROTEIN);
    // Create ComponentDefintion for CRa_U6 promoter
    ComponentDefinition CRa_U6 = doc.createComponentDefinition("CRa_U6", version, ComponentDefinition.DNA);
    CRa_U6.addRole(SequenceOntology.PROMOTER);
    CRa_U6.addSequence("CRa_U6_seq");
    // Create ComponentDefintion for gRNA_b coding sequence
    ComponentDefinition gRNA_b_nc = doc.createComponentDefinition("gRNA_b_nc", version, ComponentDefinition.DNA);
    gRNA_b_nc.addRole(SequenceOntology.CDS);
    gRNA_b_nc.addSequence("gRNA_b_seq");
    // Create ComponentDefinition for gRNA_b terminator
    doc.createComponentDefinition("gRNA_b_terminator", version, ComponentDefinition.DNA).addRole(SequenceOntology.TERMINATOR);
    // Create ComponentDefinition for gRNA_b gene
    ComponentDefinition gRNA_b_gene = doc.createComponentDefinition("gRNA_b_gene", version, ComponentDefinition.DNA);
    gRNA_b_gene.addRole(SequenceOntology.PROMOTER);
    gRNA_b_gene.createSequenceConstraint("gRNA_b_gene_constraint1", RestrictionType.PRECEDES, "CRa_U6", "gRNA_b_nc");
    gRNA_b_gene.createSequenceConstraint("gRNA_b_gene_constraint2", RestrictionType.PRECEDES, "gRNA_b_nc", "gRNA_b_terminator");
    // Create ComponentDefinition for gRNA_b RNA
    doc.createComponentDefinition("gRNA_b", version, ComponentDefinition.RNA).addRole(SequenceOntology.SGRNA);
    SequenceOntology so = new SequenceOntology();
    URI sgrna = so.getURIbyName("sgRNA");
    // Create ComponentDefinition for cas9m_BFP gRNA_b complex
    doc.createComponentDefinition("cas9m_BFP_gRNA_b", version, ComponentDefinition.COMPLEX);
    // Create ComponentDefinition for mKate coding sequence
    ComponentDefinition mKate_cds = doc.createComponentDefinition("mKate_cds", version, ComponentDefinition.DNA);
    mKate_cds.addRole(SequenceOntology.CDS);
    mKate_cds.addSequence("mKate_seq");
    // Create ComponentDefinition for mKate gene
    ComponentDefinition mKate_gene = doc.createComponentDefinition("mKate_gene", version, ComponentDefinition.DNA);
    mKate_gene.addRole(SequenceOntology.PROMOTER);
    mKate_gene.createSequenceConstraint("mKate_gene_constraint", RestrictionType.PRECEDES, "pConst", "mKate_cds");
    // Create ComponentDefinition for mKate protein
    doc.createComponentDefinition("mKate", version, ComponentDefinition.PROTEIN);
    // Create ComponentDefinition for Gal4VP16 coding sequence
    ComponentDefinition Gal4VP16_cds = doc.createComponentDefinition("Gal4VP16_cds", version, ComponentDefinition.DNA);
    Gal4VP16_cds.addRole(SequenceOntology.CDS);
    // Create ComponentDefintion for Gal4VP16 gene
    ComponentDefinition Gal4VP16_gene = doc.createComponentDefinition("Gal4VP16_gene", version, ComponentDefinition.DNA);
    Gal4VP16_gene.addRole(SequenceOntology.PROMOTER);
    Gal4VP16_gene.createSequenceConstraint("GAL4VP16_gene_constraint", RestrictionType.PRECEDES, "pConst", "Gal4VP16_cds");
    // Create ComponentDefintion for Gal4VP16 protein
    doc.createComponentDefinition("Gal4VP16", version, ComponentDefinition.PROTEIN);
    // Create ComponentDefinition for CRP_b promoter
    ComponentDefinition CRP_b = doc.createComponentDefinition("CRP_b", version, ComponentDefinition.DNA);
    CRP_b.addRole(SequenceOntology.PROMOTER);
    CRP_b.addSequence("CRP_b_seq");
    // Create ComponentDefintiion for EYFP coding sequence
    ComponentDefinition EYFP_cds = doc.createComponentDefinition("EYFP_cds", version, ComponentDefinition.DNA);
    EYFP_cds.addRole(SequenceOntology.CDS);
    // Create ComponentDefinition for EYFP gene
    ComponentDefinition EYFP_gene = doc.createComponentDefinition("EYFP_gene", version, ComponentDefinition.DNA);
    EYFP_gene.addRole(SequenceOntology.PROMOTER);
    EYFP_gene.createSequenceConstraint("EYFP_gene_constraint", RestrictionType.PRECEDES, "CRP_b", "EYFP_cds");
    // Create ComponentDefintiion for EYFP protein
    doc.createComponentDefinition("EYFP", version, ComponentDefinition.PROTEIN);
    // Create ModuleDefintion for CRISPR Repression
    ModuleDefinition CRPb_circuit = doc.createModuleDefinition("CRPb_characterization_circuit", version);
    // Create the FunctionalComponents for the ModuleDefinition CRISPR_Repression
    CRPb_circuit.createFunctionalComponent("cas9m_BFP", AccessType.PRIVATE, "cas9m_BFP", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("cas9m_BFP_gene", AccessType.PRIVATE, "cas9m_BFP_gene", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("gRNA_b", AccessType.PRIVATE, "gRNA_b", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("gRNA_b_gene", AccessType.PRIVATE, "gRNA_b_gene", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("mKate", AccessType.PRIVATE, "mKate", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("mKate_gene", AccessType.PRIVATE, "mKate_gene", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("Gal4VP16", AccessType.PRIVATE, "Gal4VP16", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("Gal4VP16_gene", AccessType.PRIVATE, "Gal4VP16_gene", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("EYFP", AccessType.PRIVATE, "EYFP", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("EYFP_gene", AccessType.PRIVATE, "EYFP_gene", version, DirectionType.NONE);
    CRPb_circuit.createFunctionalComponent("cas9m_BFP_gRNA_b", AccessType.PRIVATE, "cas9m_BFP_gRNA_b", version, DirectionType.NONE);
    /* Production of mKate from the mKate gene */
    Interaction mKate_production = CRPb_circuit.createInteraction("mKate_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
    mKate_production.createParticipation("mKate", "mKate", SystemsBiologyOntology.PRODUCT);
    mKate_production.createParticipation("mKate_gene", "mKate_gene", SystemsBiologyOntology.PROMOTER);
    // Production of GAL4VP16 from the GAL4VP16 gene
    Interaction GAL4VP16_production = CRPb_circuit.createInteraction("Gal4VP16_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
    GAL4VP16_production.createParticipation("Gal4VP16_gene", "Gal4VP16_gene", SystemsBiologyOntology.PROMOTER);
    GAL4VP16_production.createParticipation("Gal4VP16", "Gal4VP16", SystemsBiologyOntology.PRODUCT);
    // Production of cas9m_BFP from the cas9m_BFP gene
    Interaction cas9m_BFP_production = CRPb_circuit.createInteraction("cas9m_BFP_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
    cas9m_BFP_production.createParticipation("cas9m_BFP_gene", "cas9m_BFP_gene", SystemsBiologyOntology.PROMOTER);
    cas9m_BFP_production.createParticipation("cas9m_BFP", "cas9m_BFP", SystemsBiologyOntology.PRODUCT);
    // Production of gRNA_b from the gRNA_b gene
    Interaction gRNA_b_production = CRPb_circuit.createInteraction("gRNA_b_production", SystemsBiologyOntology.GENETIC_PRODUCTION);
    gRNA_b_production.createParticipation("gRNA_b_gene", "gRNA_b_gene", SystemsBiologyOntology.PROMOTER);
    gRNA_b_production.createParticipation("gRNA_b", "gRNA_b", SystemsBiologyOntology.PRODUCT);
    // Activation of EYFP production by GAL4VP16
    Interaction EYFP_Activation = CRPb_circuit.createInteraction("EYFP_Activation", SystemsBiologyOntology.STIMULATION);
    EYFP_Activation.createParticipation("Gal4VP16", "Gal4VP16", SystemsBiologyOntology.STIMULATOR);
    EYFP_Activation.createParticipation("EYFP_gene", "EYFP_gene", SystemsBiologyOntology.PROMOTER);
    // Degradation of mKate
    Interaction mKate_deg = CRPb_circuit.createInteraction("mKate_deg", SystemsBiologyOntology.DEGRADATION);
    mKate_deg.createParticipation("mKate", "mKate", SystemsBiologyOntology.REACTANT);
    // Degradation of GAL4VP16
    Interaction GAL4VP16_deg = CRPb_circuit.createInteraction("Gal4VP16_deg", SystemsBiologyOntology.DEGRADATION);
    GAL4VP16_deg.createParticipation("Gal4VP16", "Gal4VP16", SystemsBiologyOntology.REACTANT);
    // Degradation of cas9m_BFP
    Interaction cas9m_BFP_deg = CRPb_circuit.createInteraction("cas9m_BFP_deg", SystemsBiologyOntology.DEGRADATION);
    cas9m_BFP_deg.createParticipation("cas9m_BFP", "cas9m_BFP", SystemsBiologyOntology.REACTANT);
    // Degradation of gRNA_b
    Interaction gRNA_b_deg = CRPb_circuit.createInteraction("gRNA_b_deg", SystemsBiologyOntology.DEGRADATION);
    gRNA_b_deg.createParticipation("gRNA_b", "gRNA_b", SystemsBiologyOntology.REACTANT);
    // Degradation of EYFP
    Interaction EYFP_deg = CRPb_circuit.createInteraction("EYFP_deg", SystemsBiologyOntology.DEGRADATION);
    EYFP_deg.createParticipation("EYFP", "EYFP", SystemsBiologyOntology.REACTANT);
    // Degradation of cas9m_BFP_gRNA_b
    Interaction cas9m_BFP_gRNA_b_deg = CRPb_circuit.createInteraction("cas9m_BFP_gRNA_b_deg", SystemsBiologyOntology.DEGRADATION);
    cas9m_BFP_gRNA_b_deg.createParticipation("cas9m_BFP_gRNA_b", "cas9m_BFP_gRNA_b", SystemsBiologyOntology.REACTANT);
    // Create Template Module
    Module Template_Module = CRPb_circuit.createModule("CRISPR_Template", "CRISPR_Template", version);
    // Add MapsTos to Template Module
    Template_Module.createMapsTo("cas9m_BFP_map", RefinementType.USELOCAL, "cas9m_BFP", "cas9_generic");
    Template_Module.createMapsTo("gRNA_b_map", RefinementType.USELOCAL, "gRNA_b", "gRNA_generic");
    Template_Module.createMapsTo("cas9m_BFP_gRNA_map", RefinementType.USELOCAL, "cas9m_BFP_gRNA_b", "cas9_gRNA_complex");
    Template_Module.createMapsTo("EYFP_map", RefinementType.USELOCAL, "EYFP", "target");
    Template_Module.createMapsTo("EYFP_gene_map", RefinementType.USELOCAL, "EYFP_gene", "target_gene");
    // try {
    // SBOLWriter.write(doc, "/Users/myers/RepressionModel.rdf");
    // }
    // catch (XMLStreamException | FactoryConfigurationError | CoreIoException e) {
    // e.printStackTrace();
    // }
    // catch (IOException e) {
    // e.printStackTrace();
    // }
    // END of Repression Model construction. Code below uses trivial manipulations to show other major methods in the library.
    ComponentDefinition cas9_generic1 = doc.getComponentDefinition("cas9_generic", version);
    ComponentDefinition cas9_generic2 = doc.getComponentDefinition("cas9_generic", null);
    if (cas9_generic1.equals(cas9_generic2)) {
        System.out.println("Two Cas9 generic protein objects are equal.");
    }
    gRNA_b_gene.getSequenceConstraint("gRNA_b_gene_constraint1");
    CRISPR_Template.setName("C~R*I!S@P#R-based Repression Template");
    if (CRISPR_Template.isSetName()) {
        CRISPR_Template.unsetName();
        CRISPR_Template.setName("CRISPR-based Repression Template");
    }
    CRISPR_Template.setDescription("Authors: S. Kiani, J. Beal, M. Ebrahimkhani, J. Huh, R. Hall, Z. Xie, Y. Li, and R. Weiss" + "Titel: Crispr transcriptional repression devices and layered circuits in mammalian cells" + "Journal: Nature Methods, vol. 11, no. 7, pp. 723–726, 2014.");
    URI gRNA_b_gene_role2 = URI.create("http://identifiers.org/so/SO:0000613");
    gRNA_b_gene.addRole(gRNA_b_gene_role2);
    if (gRNA_b_gene.containsRole(gRNA_b_gene_role2)) {
        gRNA_b_gene.removeRole(gRNA_b_gene_role2);
    }
    gRNA_b_gene.clearRoles();
    if (!gRNA_b_gene.getRoles().isEmpty()) {
        System.out.println("gRNA_b_gene set is not empty.");
    }
    gRNA_b_gene.setRoles(new HashSet<URI>(Arrays.asList(SequenceOntology.PROMOTER)));
    CRP_b.clearSequences();
    CRP_b.addSequence("CRP_b_seq");
    // CRP_b.addSequence(
    // URI.create("http://partsregistry.org/seq/partseq_154")
    // );
    String prURI = "http://partsregistry.org/";
    String prPrefix = "pr";
    doc.addNamespace(URI.create(prURI), prPrefix);
    ComponentDefinition pConst = doc.getComponentDefinition("pConst", version);
    pConst.createAnnotation(new QName(prURI, "experience", prPrefix), URI.create("http://parts.igem.org/Part:BBa_J23119:Experience"));
    String myersLabURI = "http://www.async.ece.utah.edu/";
    String myersLabPrefix = "myersLab";
    doc.addNamespace(URI.create(myersLabURI), myersLabPrefix);
    GenericTopLevel datasheet = doc.createGenericTopLevel("datasheet", "1.1", new QName(myersLabURI, "datasheet", myersLabPrefix));
    datasheet.setName("Datasheet for Custom Parameters");
    datasheet.createAnnotation(new QName(myersLabURI, "characterizationData", myersLabPrefix), URI.create(myersLabURI + "/measurement/BBa_J23119"));
    datasheet.createAnnotation(new QName(myersLabURI, "transcriptionRate", myersLabPrefix), 0.75);
    pConst.createAnnotation(new QName(myersLabURI, "datasheet", myersLabPrefix), datasheet.getIdentity());
    ComponentDefinition pConst_alt = (ComponentDefinition) doc.createCopy(pConst, "pConst_alt");
    // pConst_alt.createAnnotation(
    // new QName(prURI, "", prPrefix),
    // URI.create("http://parts.igem.org/Part:BBa_J23100"));
    Sequence pConst_alt_seq = doc.createSequence("pConst_alt_seq", version, "ttgacggctagctcagtcctaggtacagtgctagc", Sequence.IUPAC_DNA);
    pConst_alt.addSequence(pConst_alt_seq);
    SBOLValidate.validateSBOL(doc, true, true, true);
    if (SBOLValidate.getNumErrors() > 0) {
        for (String error : SBOLValidate.getErrors()) {
            System.out.println(error);
        }
        return;
    }
    SBOLWriter.write(doc, (System.out));
    SBOLWriter.write(doc, "RepressionModel.rdf");
}